View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10049_low_29 (Length: 251)

Name: NF10049_low_29
Description: NF10049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10049_low_29
NF10049_low_29
[»] chr3 (2 HSPs)
chr3 (18-203)||(33262054-33262239)
chr3 (187-241)||(33261971-33262025)


Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 33262239 - 33262054
Alignment:
Q  18 tgaatgacccaaaatcattgagctcagctcttctgaagttgggatgttgaaaggcagacttgctggcccttgcaatgtggcattctgcggttgcaaacta 117  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||    
T  33262239 tgaatgacccaaaatcattgagctcagctcttctgaaattgggatgttgaaaggcagacttgttggcccttgcagtgtggcattctgcggttgcaaacta 33262140  T
Q  118 gtcattgttgacccctccaatatggcagtttgtggttgcagatgactaattgctggcccttccaacatggcactctgtggttgcaa 203  Q
    |||||||||||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||| |||||||| ||||    
T  33262139 gtcattgttgacccctccaatatggcagttcgtggttgcagattactaattgatggcccttccaacatggcagtctgtggtagcaa 33262054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 33262025 - 33261971
Alignment:
Q  187 gcactctgtggttgcaactcagtcatcgctggcccttgcaatatcgctctctgtg 241  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  33262025 gcactctgtggttccaactcagtcatcgctggcccttgcaatatcgctctctgtg 33261971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University