View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10049A_low_419 (Length: 209)

Name: NF10049A_low_419
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10049A_low_419
NF10049A_low_419
[»] chr3 (1 HSPs)
chr3 (21-127)||(47094327-47094433)


Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 21 - 127
Target Start/End: Complemental strand, 47094433 - 47094327
Alignment:
Q  21 taacaactatttcaaatgaacaacaaacatgctcatcactcatctcacctctattcaacaatggcacccaaaacaaaccactcaaacacgttcatcatct 120  Q
    ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  47094433 taacaactatttcaaatgaacaaaaaacattctcatcactcatctcacctctattcaacaatggcacccaaaacaaaccactcaaacactttcatcatct 47094334  T
Q  121 tcttact 127  Q
    |||||||    
T  47094333 tcttact 47094327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University