View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10049A_low_355 (Length: 229)

Name: NF10049A_low_355
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10049A_low_355
NF10049A_low_355
[»] chr7 (1 HSPs)
chr7 (7-145)||(7127620-7127758)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 7 - 145
Target Start/End: Complemental strand, 7127758 - 7127620
Alignment:
Q  7 acacgagccttcacacgtgtcggatacaacgtgtcaagaacaattagagttctctgaaaatcacagtgttgatgttgatcttgtggattctacaattgtt 106  Q
    |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||     
T  7127758 acacgagccttcacacgtgttggatacaacgtgtcaagaacaattagtgttctctgaaaatcacagtgttgatgttgatcttgtggattctgcaattgta 7127659  T
Q  107 gccactgcaacttcttcgtcgctgtccctgaatttcaac 145  Q
    |||||||||||||||||||||||||||||||||||||||    
T  7127658 gccactgcaacttcttcgtcgctgtccctgaatttcaac 7127620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University