View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10049A_low_192 (Length: 267)

Name: NF10049A_low_192
Description: NF10049A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10049A_low_192
NF10049A_low_192
[»] chr8 (1 HSPs)
chr8 (1-107)||(8699769-8699875)


Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 8699875 - 8699769
Alignment:
Q  1 ggaatctcctacaagtcttgatttcaaatctagaagagttttgtgattcattgtgatgccttacccgacttaaggaattagtctatacactttgcacaaa 100  Q
    ||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |    
T  8699875 ggaatctcctagaggtcttgatttcaaatctagaagagttttgtaattcattgtgatgccttacccgatttaaggaattagtttatacactttgcacaga 8699776  T
Q  101 gataccc 107  Q
    |||||||    
T  8699775 gataccc 8699769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University