View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10045_low_28 (Length: 213)

Name: NF10045_low_28
Description: NF10045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10045_low_28
NF10045_low_28
[»] chr5 (1 HSPs)
chr5 (22-211)||(12356109-12356299)
[»] chr7 (1 HSPs)
chr7 (163-197)||(9397833-9397867)


Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 211
Target Start/End: Original strand, 12356109 - 12356299
Alignment:
Q  22 accactatctctctttcataggtctgagttcatccgtcgaccaccagccactggagacgcacctgttctgttcaacctctctcacaacatgcgcctcacg 121  Q
    ||||| |||||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  12356109 accacaatctctctttcacaggtctgagttcatccgccgaccaccagccactagagacgcacctgttctgttcaacctctctcacaacatgcgcctcacg 12356208  T
Q  122 caattcaattgcagacaaccaacatagtcttccaccttc-accccccaccgatgagaagatctcacgatctactgtttcaatctacagtct 211  Q
    |||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||| |||||||||||| |||||||||||    
T  12356209 caattcaattgcagacaaccaacatagtcttccaccttctcccccccaccgatgagaagatctcacaatctactgtttcgatctacagtct 12356299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 197
Target Start/End: Complemental strand, 9397867 - 9397833
Alignment:
Q  163 cccccaccgatgagaagatctcacgatctactgtt 197  Q
    |||||||||| ||||||||||||||||||||||||    
T  9397867 cccccaccgacgagaagatctcacgatctactgtt 9397833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University