View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10041_low_62 (Length: 248)

Name: NF10041_low_62
Description: NF10041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10041_low_62
NF10041_low_62
[»] chr6 (1 HSPs)
chr6 (31-150)||(10279164-10279283)


Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 31 - 150
Target Start/End: Original strand, 10279164 - 10279283
Alignment:
Q  31 cacattgttctgaagtaactttaatatttttactagtgataatcaataagtagaacatgattgttaatgcttacaaaattaatacacacatagacatata 130  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||    
T  10279164 cacatttttctgaagtaactttaatatttttactagtgataatcaataagtagaacatgattgttaatgctaacaaagttaatacacacatagacatata 10279263  T
Q  131 caaataaaatttatcaatta 150  Q
    ||||||||||||||||||||    
T  10279264 caaataaaatttatcaatta 10279283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University