View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10039_low_56 (Length: 215)

Name: NF10039_low_56
Description: NF10039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10039_low_56
NF10039_low_56
[»] chr3 (1 HSPs)
chr3 (1-215)||(33931861-33932075)


Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 33931861 - 33932075
Alignment:
Q  1 agaattaggatgactgacaaagttctactcaagagtttataactgaagttgtatatgcaaatgatcaaagtgtaagatagatattatatgtattatgaat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  33931861 agaattaggatgactgacaaagttctactcaagagtttataactgaagttgtatatgcaaatgatcaaagtgtaagatagatataatatgtattatgaat 33931960  T
Q  101 aattttggctaagggtatcaaatatgaaatatgaattatcaagttgtttttggtgttaaaaatatgaatttagcttcctgtatatatatagatacggttt 200  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||    
T  33931961 atttttggctaagggtatcaaatatgaaatatgaattatcaagttgtttttgatgttaaaaatatgaatctagcttcctgtatatatatagatacggttt 33932060  T
Q  201 gatgtcggtttgttg 215  Q
    |||||||||||||||    
T  33932061 gatgtcggtttgttg 33932075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University