View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10038_low_34 (Length: 240)

Name: NF10038_low_34
Description: NF10038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10038_low_34
NF10038_low_34
[»] chr7 (1 HSPs)
chr7 (1-209)||(6497293-6497501)


Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 6497501 - 6497293
Alignment:
Q  1 cgtgaaatactatatatctaggcttcatagaactccagtaacagatatcagaaatgcaaacagaattattaattatgcacaataaaagtaatgtaaaaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6497501 cgtgaaatactatatatctaggcttcatagaactccagtaacagatatcagaaatgcaaacagaattattaattatgcacaataaaagtaatgtaaaaac 6497402  T
Q  101 aagcttcatgtcttaatggcaggttgatatctctccctgagggatgagaggcaggggggctctgtgaatcaatcagttgtgcaacaaaacggataagctc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||    
T  6497401 aagcttcatgtcttaatggcaggttgatatctctccctgagggatgagaggcaggggggctctgcgaatcaatcagttgtgcaacaaaacagataagctc 6497302  T
Q  201 aattcatgt 209  Q
    |||||||||    
T  6497301 aattcatgt 6497293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University