View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10036_low_19 (Length: 260)

Name: NF10036_low_19
Description: NF10036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10036_low_19
NF10036_low_19
[»] chr5 (2 HSPs)
chr5 (18-115)||(2176453-2176550)
chr5 (180-242)||(2176326-2176388)


Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 2176550 - 2176453
Alignment:
Q  18 cagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacatnnnnnnntgactgataatttgtattttcaacatctaact 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||| ||||||||||||||||    
T  2176550 cagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacataaaaaaatgactgataatttgtcttttcaacatctaact 2176453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 180 - 242
Target Start/End: Complemental strand, 2176388 - 2176326
Alignment:
Q  180 gttttacttctaagaacaatttattcgagtcaatcagttaattattgattttcttgacattgg 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2176388 gttttacttctaagaacaatttattcgagtcaatcagttaattattgattttcttgacattgg 2176326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University