View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10036_high_17 (Length: 255)

Name: NF10036_high_17
Description: NF10036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10036_high_17
NF10036_high_17
[»] chr4 (1 HSPs)
chr4 (18-153)||(56182472-56182603)


Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 18 - 153
Target Start/End: Original strand, 56182472 - 56182603
Alignment:
Q  18 tggtaagttaattatagccttccttttttgacttcccactcctcaaccctattaattaataaataaataaattaaaagcttaaagcttatttttcttttt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||    
T  56182472 tggtaagttaattatagccttccttttttgacttcccactcctcaaccctattaattaata----aataaattaaaagcttaaagcttatttttcttttt 56182567  T
Q  118 ctataaagatgaatatcacttttggcagaggatatg 153  Q
    |||||||||||||||||||||||||||| |||||||    
T  56182568 ctataaagatgaatatcacttttggcagtggatatg 56182603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University