View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10031_low_6 (Length: 396)

Name: NF10031_low_6
Description: NF10031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10031_low_6
NF10031_low_6
[»] chr5 (1 HSPs)
chr5 (123-378)||(15935878-15936133)


Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 123 - 378
Target Start/End: Complemental strand, 15936133 - 15935878
Alignment:
Q  123 ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggnnnnnnngtttgttatatccaaaacagta 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||    
T  15936133 ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggtttttttgtttgttatatccaaaacagta 15936034  T
Q  223 gggttaaatactcatactcaaatatcacgtaacctaacctaacctgcctgctaaacaaacacaaacagatacaggatggcttccggctccggcaacgtcg 322  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15936033 gggttaaatactcatactaaaatatcacgtaacttaacctaacctgcctgctaaacaaacacaaacagatacaggatggcttccggctccggcaacgtcg 15935934  T
Q  323 tggacgaaaagttcgacccactcattcggcaagtggccatcagattggcaaacaag 378  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  15935933 tggacgaaaagttcgacccgctcattcggcaagtggccatcagattggcaaacaag 15935878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University