View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10014_high_3 (Length: 296)

Name: NF10014_high_3
Description: NF10014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10014_high_3
NF10014_high_3
[»] chr3 (1 HSPs)
chr3 (17-122)||(44869327-44869432)


Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 17 - 122
Target Start/End: Complemental strand, 44869432 - 44869327
Alignment:
Q  17 ataaacatctttattatcagtcctccatatttgcttatcctcccttcgaccatagatggtgggcacttttccttatctcactcacattcattcaaaacat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44869432 ataaacatctttattatcagtcctccatatttgcttatcctcccttccaccatagatggtgggcacttttccttatctcactcacattcattcaaaacat 44869333  T
Q  117 cgttta 122  Q
    ||||||    
T  44869332 cgttta 44869327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University