View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0991_low_16 (Length: 234)

Name: NF0991_low_16
Description: NF0991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0991_low_16
NF0991_low_16
[»] chr5 (1 HSPs)
chr5 (1-205)||(4831035-4831239)


Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 4831239 - 4831035
Alignment:
Q  1 agaaggagattctccattaggactagaactattgaaggaagcaaaagcattattattagggtttggtaaatggtaaagaaggcacaatccagcattagca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4831239 agaaggagattctccattaggactagaactattgaaggaagcaaaagcattattattagggtttggtaaatggtaaagaaggcacaatccagcattagca 4831140  T
Q  101 acaaggtcttgtggaggaatatttatgaatggtgatgaaggatgagatgaatttaacggtggttgggtttgatggagacgagcacggtcgcggcggtgaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4831139 acaaggtcttgtggaggaatatttatgaatggtgatgaaggatgagaagaatttaacggtggttgggtttgatggagacgagcacggtcgcggcggtgaa 4831040  T
Q  201 cattc 205  Q
    |||||    
T  4831039 cattc 4831035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University