View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0971_low_7 (Length: 267)

Name: NF0971_low_7
Description: NF0971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0971_low_7
NF0971_low_7
[»] chr3 (1 HSPs)
chr3 (20-227)||(34675159-34675366)
[»] chr4 (1 HSPs)
chr4 (20-206)||(43583166-43583355)
[»] chr7 (1 HSPs)
chr7 (54-142)||(12360773-12360861)


Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 20 - 227
Target Start/End: Complemental strand, 34675366 - 34675159
Alignment:
Q  20 gtgagggaggagttcgttgaggatctttgtgacgttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34675366 gtgagggaggagttcgttgaggatctttgtgacgttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggt 34675267  T
Q  120 gcaaagatgcagcctggcatgcattttcgacgaaggaatttgcaggctgcacatggtgaattgtatgagcttgatgatgccattttttctcctgcgctac 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34675266 gcaaagatgcagcctggcatgcattttcgacgaaggaatttgcaggctgcacatggtgaattgtatgagcttgatgatgccattttttctcctgcgctac 34675167  T
Q  220 aaagcaat 227  Q
    ||||||||    
T  34675166 aaagcaat 34675159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 20 - 206
Target Start/End: Complemental strand, 43583355 - 43583166
Alignment:
Q  20 gtgagggaggagttcgttgaggatctttgtgacgttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggt 119  Q
    ||||||||| ||||| ||||| | ||||||||| ||||| || || || || ||||| |||||||||||||||||||| ||||| || || ||||| |||    
T  43583355 gtgagggagaagttcattgagaagctttgtgacattgctagcaccaaatattttgtgcacgtttgcaaatttttgaggctcttctggagggaagtaaggt 43583256  T
Q  120 gcaaagatgcagcctggcatgcattttcgacgaaggaatttgcaggctgcacatggtgaattgtatgagct---tgatgatgccattttt 206  Q
    ||||||||||| ||||||||||||||||  |  | |||||||||||| ||||| |||||||||||||||||   ||||||||||||||||    
T  43583255 gcaaagatgcatcctggcatgcattttctcctcaagaatttgcaggcagcacaaggtgaattgtatgagctggatgatgatgccattttt 43583166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 54 - 142
Target Start/End: Original strand, 12360773 - 12360861
Alignment:
Q  54 ttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggtgcaaagatgcagcctggcatgca 142  Q
    |||||||| || || || |||||||| |||||||||||||| |||||||| ||||| || ||||| ||||| |||||  ||||||||||    
T  12360773 ttgcttgcaccaaatattttgtgaacatttgcaaatttttgtggttcttctggtgggaaatatggagcaaatatgcaatctggcatgca 12360861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University