View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0965_low_38 (Length: 209)

Name: NF0965_low_38
Description: NF0965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0965_low_38
NF0965_low_38
[»] chr2 (1 HSPs)
chr2 (1-78)||(3895341-3895418)


Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 3895341 - 3895418
Alignment:
Q  1 acatggctgataagacaaaagaaggagctgagaaaacggcagagaagacgggggaggttgctgggtcggcgacagagg 78  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  3895341 acatggctgataagacaaaagaaggagctgagaaaacggcggagaagacgggggaggttgctgggtcggcgacagagg 3895418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University