View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0965_high_18 (Length: 266)

Name: NF0965_high_18
Description: NF0965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0965_high_18
NF0965_high_18
[»] chr8 (2 HSPs)
chr8 (13-131)||(4893378-4893496)
chr8 (175-238)||(4892928-4892991)


Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 13 - 131
Target Start/End: Complemental strand, 4893496 - 4893378
Alignment:
Q  13 aatataatttatagtaactcttgtgagacatgccccttgttagtaagatcttcacatttgtttgcttctctttaaatataatatgatatgataggtaaga 112  Q
    |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  4893496 aatataatttatagtaactcttgtgagacacgccccttgttagtaaggtcttcacatttgtttgcttctctttaaatatgatatgatatgataggtaaga 4893397  T
Q  113 gttctccatgaagaaagtt 131  Q
    |||||||||||||||||||    
T  4893396 gttctccatgaagaaagtt 4893378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 175 - 238
Target Start/End: Complemental strand, 4892991 - 4892928
Alignment:
Q  175 ttgtgattaattgatttttaaaaagtaaatcaaataatcaagaacaatatattggaaagtacct 238  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  4892991 ttgtgattaattgatttttaaaaagtaaatcaattaatcaagaacaatatattggaaagtacct 4892928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University