View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0961_low_49 (Length: 216)

Name: NF0961_low_49
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0961_low_49
NF0961_low_49
[»] chr4 (1 HSPs)
chr4 (1-128)||(35204594-35204721)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 35204594 - 35204721
Alignment:
Q  1 aatgtgatgaatttagttgttacggtcttacaattctatggacaaaattggatatttactccttgttttccctccacttcatctactgcatctatgattt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35204594 aatgtgatgaatttagttgttacggtcttacaattctatggacaaaattggatatttactccttgttttccctccacttcatctactgcatctatgattt 35204693  T
Q  101 aatttctcttcgtctttgtttttcattc 128  Q
    ||||||||||| | ||||||||||||||    
T  35204694 aatttctcttcttttttgtttttcattc 35204721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University