View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0960_low_36 (Length: 233)

Name: NF0960_low_36
Description: NF0960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0960_low_36
NF0960_low_36
[»] chr4 (1 HSPs)
chr4 (29-88)||(1090754-1090813)


Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 88
Target Start/End: Original strand, 1090754 - 1090813
Alignment:
Q  29 cgaagcttaagaaagttcactattggacgannnnnnnacatcggttttagatggcaaacg 88  Q
    ||||||||||||||||||||||||||||||       ||||||||||||||| |||||||    
T  1090754 cgaagcttaagaaagttcactattggacgatttttttacatcggttttagatagcaaacg 1090813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University