View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0959_high_14 (Length: 313)

Name: NF0959_high_14
Description: NF0959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0959_high_14
NF0959_high_14
[»] chr3 (1 HSPs)
chr3 (1-226)||(32540037-32540257)


Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 32540257 - 32540037
Alignment:
Q  1 tgaatgtcctgatggaacagtattatttttgttctttttcattgcttttgtcctgaatctcctgccacttccccaaccaagcttggcttggcttggctct 100  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||     ||    
T  32540257 tgaatctcctgatggaacagtattatttttgttctttttcattgcttttgtcctgaatctcctgccacttccccaaccaagcttggtttggct-----ct 32540163  T
Q  101 tgatcagtctcacacagaccttttgtggcataggctctcataattgccatcactacattttacttttggttttcctttaccaccacaacaacactaacac 200  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32540162 tgatcagtctcacacagaccttttgtggcacaggctctcataattgccatcactacattttacttttggttttcctttaccaccacaacaacactaacac 32540063  T
Q  201 gtattgcaacttcaatgaaacattga 226  Q
    ||||||||||||||||||||||||||    
T  32540062 gtattgcaacttcaatgaaacattga 32540037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University