View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0955_low_18 (Length: 228)

Name: NF0955_low_18
Description: NF0955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0955_low_18
NF0955_low_18
[»] chr2 (1 HSPs)
chr2 (1-112)||(19172460-19172571)


Alignment Details
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 19172571 - 19172460
Alignment:
Q  1 tcgttctatctccggcgcctccttaaccctcctctcaactcacgttgagctcatccaccaacacttccaatcttactaccacaccctcgacgcagctgca 100  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19172571 tcgttctatctccggcgactccttaaccctcctctcaactcacgttgagctcatccaccaacacttccaatcttactaccacaccctcgacgcagctgca 19172472  T
Q  101 accacagaccct 112  Q
    | ||||||||||    
T  19172471 atcacagaccct 19172460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University