View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0955_low_12 (Length: 270)

Name: NF0955_low_12
Description: NF0955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0955_low_12
NF0955_low_12
[»] chr2 (1 HSPs)
chr2 (49-241)||(3131709-3131901)


Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 49 - 241
Target Start/End: Original strand, 3131709 - 3131901
Alignment:
Q  49 gtagagagtgccagtggcaataccgaggagcacgatgaggaggaaggttaatgccataaaccaacaaaagcaacggcatcgccggttagggcgttgtctt 148  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3131709 gtagagagtgccagtagcaataccgaggagcacgatgaggaggaaggttaatgccataaaccaacaaaagcaacggcatcgccggttagggcgttgtctt 3131808  T
Q  149 aggcgagtgtattcttggtagcggcgagctttctccgatggagagacactgaaggtttgattcttgggagctttgatgactagggctctctgc 241  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3131809 aggcgagtgtattcttggtagcggcgagctttctccgatggagagacactgaaggtttgattcttgggagctttgatgactagggctctctgc 3131901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University