View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0954_low_40 (Length: 211)

Name: NF0954_low_40
Description: NF0954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0954_low_40
NF0954_low_40
[»] chr5 (1 HSPs)
chr5 (89-211)||(5979903-5980025)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 89 - 211
Target Start/End: Original strand, 5979903 - 5980025
Alignment:
Q  89 atgaatgaatatatgtaccttaaaatttaagtaatttatttttattattttggtcgaaccgacaccaattaggtcactgtctcggccgtaagaatgctaa 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||    
T  5979903 atgaatgaatatatgtaccttaaaatttaagtaatttatttttattattttggtcgaaccgacaccaattaggtcaccgtctcggccgtaaaaatgctaa 5980002  T
Q  189 agaccataaacttctaccgttaa 211  Q
    |||||||||||||||||||||||    
T  5980003 agaccataaacttctaccgttaa 5980025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University