View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0953_low_92 (Length: 252)

Name: NF0953_low_92
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0953_low_92
NF0953_low_92
[»] chr3 (2 HSPs)
chr3 (1-75)||(50511291-50511365)
chr3 (147-223)||(50511437-50511512)


Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 50511291 - 50511365
Alignment:
Q  1 taatgtgtgtgaatattgtacactctcaaatactgaatttcattcttaaaaactagagtactagctagctaagag 75  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50511291 taatgtgtgtgaatattgtacactctcaaatactgaatttcattcttaaaaactagagtactagctagctaagag 50511365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 147 - 223
Target Start/End: Original strand, 50511437 - 50511512
Alignment:
Q  147 cccaaaacaagtagagcataattccactatcctcttgtttggacgtttactttggtggaagaagaaatacctcaaat 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  50511437 cccaaaacaagtagagcataattccactatcctcttgtttggacg-ttactttggtggaagaagaaatacctcaaat 50511512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University