View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0950_low_33 (Length: 299)

Name: NF0950_low_33
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0950_low_33
NF0950_low_33
[»] chr7 (1 HSPs)
chr7 (57-299)||(43372928-43373170)


Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 57 - 299
Target Start/End: Complemental strand, 43373170 - 43372928
Alignment:
Q  57 agataatactcataactactctctagattctgactcactcgatgatttaggagattcagaccgggggaatgaggattcaagtgttgggaattcattccgt 156  Q
    |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43373170 agataatactcataactactctctcgattttgactcactcgatgatttaggagattcagaccgggggaatgaggattcaagtgttgggaattcattccgt 43373071  T
Q  157 tatggaacattggcctctgcaaatgctggaggatcatgttcttattattccaacacgagaatgaattgtgatgagaaagacatttgggtttaccacagct 256  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  43373070 tatggaacattggcctccgcaaatgctggaggatcatgttcttattattcaaacacgagaatgaattgtgatgagaaagacatttgggtttaccacagct 43372971  T
Q  257 attgcatgcctgatgccgggcgttcgcatatggatgaatctac 299  Q
    |||||||||||||||| ||||||||||||||||||||||||||    
T  43372970 attgcatgcctgatgctgggcgttcgcatatggatgaatctac 43372928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University