View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0950_low_17 (Length: 397)

Name: NF0950_low_17
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0950_low_17
NF0950_low_17
[»] chr5 (1 HSPs)
chr5 (130-298)||(24094387-24094555)
[»] chr1 (1 HSPs)
chr1 (292-373)||(35916494-35916575)


Alignment Details
Target: chr5 (Bit Score: 136; Significance: 8e-71; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 130 - 298
Target Start/End: Original strand, 24094387 - 24094555
Alignment:
Q  130 catcaaaaccccaactgctatgacccagatgcaatctttcccaaacgatgaaggaatttcaaacccatcaccttcgtttgtcaaccacaaatgaaaattt 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||||||||    
T  24094387 catcaaaaccccaactgctatgacccagatgcaatctttcccaaacgatgaaggaatttcaaacccgtcaccgtcgtttgtcacccacaaatgaaaattt 24094486  T
Q  230 ccattgcgagtgatttcaacgcaaggtaaatcagannnnnnncaaatcaaatctgctaaaatcagtctt 298  Q
    |||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||    
T  24094487 ccattgcgagtgatttcaacgcaaggtaaatcagatttttttcaaatcaaatctgctaaaatcagtctt 24094555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 292 - 373
Target Start/End: Original strand, 35916494 - 35916575
Alignment:
Q  292 cagtcttctggaagtggaagttgagctgtttcccacaaagggattgatgttgtttcgaaagatgcacatacaaagaaagagg 373  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35916494 cagtcttctggaagtggaagttgagctgtttcccacaaagggattgatgttgtttcgaaagatgcacatacaaagaaagagg 35916575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University