View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0950_high_22 (Length: 217)

Name: NF0950_high_22
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0950_high_22
NF0950_high_22
[»] chr6 (1 HSPs)
chr6 (2-113)||(21376931-21377042)


Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 2 - 113
Target Start/End: Original strand, 21376931 - 21377042
Alignment:
Q  2 caaaccaacaccttcactcttcgatttggatttggaagttttgtcttcccgaaaaatataaatttcttttttggctgacttgtaacaatccggttcctac 101  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21376931 caaaccaacaccttcactctttgatttggatttggaagttttgtcttcccgaaaaatataaatttcttttttggctgacttgtaacaatccggttcctac 21377030  T
Q  102 ctcatctctgct 113  Q
    || |||| ||||    
T  21377031 cttatctttgct 21377042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University