View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0949_low_4 (Length: 430)

Name: NF0949_low_4
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0949_low_4
NF0949_low_4
[»] chr3 (2 HSPs)
chr3 (273-399)||(53604672-53604798)
chr3 (128-208)||(53604514-53604603)


Alignment Details
Target: chr3 (Bit Score: 111; Significance: 7e-56; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 273 - 399
Target Start/End: Original strand, 53604672 - 53604798
Alignment:
Q  273 tctaattatatggcaatttatatgattaatttttgtttgcagatggtatcttttgttcagagtatgatgcttagagtggttccttccattttgagttaga 372  Q
    ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53604672 tctaattatatggcaatttatattattactttttgtttgcagatggtatcttttgttcagagtatgatgcttagagtggttccttccattttgagttaga 53604771  T
Q  373 tggacatagttgatcagaaatctaatt 399  Q
    ||||||| |||||||||||| ||||||    
T  53604772 tggacatggttgatcagaaacctaatt 53604798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 128 - 208
Target Start/End: Original strand, 53604514 - 53604603
Alignment:
Q  128 aggcacctttcaattttcctggcttcagtat---------tggaattgcttgtgtaagaacttactttaatcaaagttctccatgctctc 208  Q
    |||||||||| ||||||||||||||||||||         |||||||||||  |||||||||||||||||||||||||||||||||||||    
T  53604514 aggcaccttttaattttcctggcttcagtataatgtgcattggaattgcttcggtaagaacttactttaatcaaagttctccatgctctc 53604603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University