View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0949_low_14 (Length: 325)

Name: NF0949_low_14
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0949_low_14
NF0949_low_14
[»] chr3 (1 HSPs)
chr3 (82-231)||(38701514-38701670)


Alignment Details
Target: chr3 (Bit Score: 119; Significance: 9e-61; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 82 - 231
Target Start/End: Original strand, 38701514 - 38701670
Alignment:
Q  82 gaaggggaaagttatcaacaaataaggtgaaattttaaaagagaatggaatcgtgggagaaataaaaagtatgagggaaatagagctaatgggttggatt 181  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||    
T  38701514 gaaggggaaagttatcaacaaatgaggtgaaattttaaaagagaatggaatcgtgggagagataaaaagtatgagggagatagagctaatgggttggatt 38701613  T
Q  182 tggt-------gaccatgataagtttagtcacttgatctaatctagtgatggaaaaa 231  Q
    ||||       ||||||||||||||||||||||||||||||||||||||||||||||    
T  38701614 tggtgctgctagaccatgataagtttagtcacttgatctaatctagtgatggaaaaa 38701670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University