View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0948_low_38 (Length: 217)

Name: NF0948_low_38
Description: NF0948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0948_low_38
NF0948_low_38
[»] chr6 (1 HSPs)
chr6 (22-140)||(2384990-2385108)


Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 22 - 140
Target Start/End: Original strand, 2384990 - 2385108
Alignment:
Q  22 gtgttatcagttgagcaaacggtatgaaaattctgtcgtataacggcatcaatagtataatggacaaggttatagcactttggagtgtggcgggtggtat 121  Q
    |||||||||| || || ||||||||||||||||||| ||||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||    
T  2384990 gtgttatcagctgcgcgaacggtatgaaaattctgttgtataacggcatcaatagtattatagacaatgttatagcactttggagtgtggcgggtggtat 2385089  T
Q  122 cttgaaatttgaacctatg 140  Q
    |||||||||||||||||||    
T  2385090 cttgaaatttgaacctatg 2385108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University