View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0948_low_26 (Length: 329)

Name: NF0948_low_26
Description: NF0948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0948_low_26
NF0948_low_26
[»] chr7 (1 HSPs)
chr7 (50-283)||(32017077-32017310)


Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 50 - 283
Target Start/End: Original strand, 32017077 - 32017310
Alignment:
Q  50 gagatgaatgttgatgagattgaaggttttgccttgcctattttactagtggaattgggatcctgaagattgcttaagaaggtagtatttaaggggggag 149  Q
    |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32017077 gagatggatgttgatgagattgaaggttttgccttgcctattttacgagtggaattgggatcctgaagattgcttaagaaggtagtatttaaggggggag 32017176  T
Q  150 ggtctgtgtttttcgagctgtgctctctgggttggttcacagcaggttttgttggtgttttcccctatgcggctgttctgctatctgtagtagtgctgct 249  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  32017177 ggtctgtgtttttcgagctgtgctctctgggttggttcacagcaggttttgttggttttttcccctatgcggctgttctgctatctgtagtagtgctgct 32017276  T
Q  250 gtcttnnnnnnntgcggggagtgttgttttctgc 283  Q
    |||||       ||||||||||||||||| ||||    
T  32017277 gtcttgggggggtgcggggagtgttgtttactgc 32017310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University