View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0947_low_98 (Length: 202)

Name: NF0947_low_98
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0947_low_98
NF0947_low_98
[»] chr3 (1 HSPs)
chr3 (20-61)||(33858611-33858652)


Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 33858611 - 33858652
Alignment:
Q  20 cttgctaaatttgcaatgccaacagtgttttatttcttcttt 61  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  33858611 cttgctaaatttgcaatgccaacagtgttttatttcttcttt 33858652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University