View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0947_low_55 (Length: 310)

Name: NF0947_low_55
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0947_low_55
NF0947_low_55
[»] chr6 (1 HSPs)
chr6 (100-210)||(28706569-28706680)
[»] chr3 (1 HSPs)
chr3 (1-58)||(51805611-51805668)
[»] chr4 (1 HSPs)
chr4 (1-58)||(20017396-20017453)


Alignment Details
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 100 - 210
Target Start/End: Complemental strand, 28706680 - 28706569
Alignment:
Q  100 gtcttagataggctccctattcgtgtgttccttg-ttataaacgagtcttgaatacggaggcctcgttgaattgtgttttctatgttggtggataagaga 198  Q
    |||||||||||| |||||| |||||||  ||||  ||||| |||||| |||||||||||||||  |||||| ||||||||||||||||||||||||||||    
T  28706680 gtcttagataggatccctactcgtgtgaacctttcttatagacgagttttgaatacggaggccatgttgaactgtgttttctatgttggtggataagaga 28706581  T
Q  199 catcaattcacc 210  Q
    ||| ||||||||    
T  28706580 cattaattcacc 28706569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 51805611 - 51805668
Alignment:
Q  1 gctgttgcaagtttttcaacaatccaagttcttttagaatttgacctgtgaggaaatt 58  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  51805611 gctgttgcaagtttttcaacaatccaagttcttttggaatttgacctgtgaggaaatt 51805668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 20017453 - 20017396
Alignment:
Q  1 gctgttgcaagtttttcaacaatccaagttcttttagaatttgacctgtgaggaaatt 58  Q
    |||||||||||||||||||||||||||| |||    ||||||||| || |||||||||    
T  20017453 gctgttgcaagtttttcaacaatccaagctctgaaggaatttgacttgcgaggaaatt 20017396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University