View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0946_low_27 (Length: 250)

Name: NF0946_low_27
Description: NF0946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0946_low_27
NF0946_low_27
[»] chr3 (1 HSPs)
chr3 (35-240)||(55117378-55117583)


Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 35 - 240
Target Start/End: Original strand, 55117378 - 55117583
Alignment:
Q  35 ctacttatatacgaatatcacgatctttacttaatttgggtattcannnnnnnnnnnnnnnnnnaactggattggatatccgtggtgtgagactacaaag 134  Q
    ||||||||||||||||||||||||||||||||||||||||||||||                  ||||||||||||||||||||||||||||||||||||    
T  55117378 ctacttatatacgaatatcacgatctttacttaatttgggtattcattttttatgtttttttttaactggattggatatccgtggtgtgagactacaaag 55117477  T
Q  135 agtaatccttcaaaatatggtaggacaaattaacaatcaataacaaagttttctatcaaacaacataacgttgctgcattgtcgttttaaatgagatatg 234  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||    
T  55117478 agtaatccttcaaaatatggtaggacaaattaacaatcaataacaaagttttctatcaaacaacttaacgttgctgcattgtcattttaaatgagatatg 55117577  T
Q  235 cctttg 240  Q
     |||||    
T  55117578 tctttg 55117583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University