View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_38 (Length: 324)

Name: NF0945_low_38
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_38
NF0945_low_38
[»] chr4 (2 HSPs)
chr4 (92-295)||(40820066-40820269)
chr4 (11-49)||(40820312-40820350)


Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 92 - 295
Target Start/End: Complemental strand, 40820269 - 40820066
Alignment:
Q  92 tatacagatagaaacttctattgctcgaatgaggcttgatcgttgccattacctccaaaaatcaaacatttttgttgccgtttactccagttttgccttc 191  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40820269 tatacagatagaaacttctgttgctcgaatgaggcttgatcgttgccattacctccaaaaatcaaacatttttgttgccgtttactccagttttgccttc 40820170  T
Q  192 ccaccagattcaacttccaccatggaggtgtccttttccaaatgacatgtgtgatgtgtgataatgcagtagagtatgatattcacatgttctttggatg 291  Q
    |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  40820169 ccaccagattcaacctccaccatggaggtgttcttttccaaatgacatgtgtgatgtgtgataatgcagtagagtatgatattcacatgttctttggata 40820070  T
Q  292 tgct 295  Q
    ||||    
T  40820069 tgct 40820066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 49
Target Start/End: Complemental strand, 40820350 - 40820312
Alignment:
Q  11 cataggtcattaactcgtttctatatcttaggagttagg 49  Q
    |||||||||||||||||||||||| ||||||||||||||    
T  40820350 cataggtcattaactcgtttctatctcttaggagttagg 40820312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University