View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0944_high_28 (Length: 252)

Name: NF0944_high_28
Description: NF0944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0944_high_28
NF0944_high_28
[»] chr8 (1 HSPs)
chr8 (1-69)||(39985093-39985161)


Alignment Details
Target: chr8 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 39985161 - 39985093
Alignment:
Q  1 attcatcagcgtttgcatgattattggtttcaatcatcaccacctgtgacatatctgttgggcaacgta 69  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39985161 attcatcagcgtttgcatgattattggtttcaatcatcaccacctgtgacatatctgttgggcaacgta 39985093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University