View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0940_low_42 (Length: 219)

Name: NF0940_low_42
Description: NF0940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0940_low_42
NF0940_low_42
[»] chr2 (1 HSPs)
chr2 (1-130)||(28216335-28216464)


Alignment Details
Target: chr2 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 28216335 - 28216464
Alignment:
Q  1 agattgtaaacatatttataatccagaggactcctaagtttgtgcatgataataaactttaaacttaagatgtaacaactaaaattgatgctgtcaagtt 100  Q
    ||||||||||||||||||||||||  ||||||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28216335 agattgtaaacatatttataatcctaaggactcctaatttcgtgcatcataataaactttaaacttaagatgtaacaactaaaattgatgctgtcaagtt 28216434  T
Q  101 gtaatggttgtaaccaaccatttacaccat 130  Q
    |||||||||||| |||||||||||||||||    
T  28216435 gtaatggttgtagccaaccatttacaccat 28216464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University