View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0935_low_14 (Length: 273)

Name: NF0935_low_14
Description: NF0935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0935_low_14
NF0935_low_14
[»] chr5 (2 HSPs)
chr5 (129-241)||(13312141-13312253)
chr5 (45-134)||(13312318-13312407)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 129 - 241
Target Start/End: Complemental strand, 13312253 - 13312141
Alignment:
Q  129 ctgcatgttgtcaccatattcacagaaccatcagttatatatcccagttgggaaaatgacaatgacagttgataatctgtcttgtctgtggcatctacca 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||    
T  13312253 ctgcatgttgtcaccatattcacagaaccatcagttatatatcccagttgggaaaatgacaatgacagttgataatgtgtctcgtctgtggcatctatca 13312154  T
Q  229 atccatgtctgtg 241  Q
    |||||||||||||    
T  13312153 atccatgtctgtg 13312141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 45 - 134
Target Start/End: Complemental strand, 13312407 - 13312318
Alignment:
Q  45 atcatcattataaagactctaaaagaaggatggttcacaaacgcaattacaaatagtgcacacgagctattgctaatttgatcactgcat 134  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||    
T  13312407 atcatcattataaagactctaaaagaaggatggttcacaaacgcaattacaaatagtgcacacaagctattactaatttgatcactgcat 13312318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University