View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0934_low_40 (Length: 281)

Name: NF0934_low_40
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0934_low_40
NF0934_low_40
[»] chr7 (2 HSPs)
chr7 (47-221)||(47052225-47052399)
chr7 (163-213)||(48108568-48108618)


Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 47052225 - 47052399
Alignment:
Q  47 aaagaatcgataattgtgccctgaaagttcttgataaactgatcaactctctctacaaaaacacccgcactcttatacaaattgacttgtttatcctccg 146  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||    
T  47052225 aaagaatcgataattgtgccctgaaagttcttgataaactgatcaactctctctacaaaaacacccgcacacttatccaaattgacttgtttatcctccg 47052324  T
Q  147 tatcagaagcattaacgagatagccggattgtagcagatcgtgttcagtggttccaagcatgaagatgtcaaaga 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47052325 tatcagaagcattaacgagatagccggattgtagcagatcgtgttcagtggttccaagcatgaagatgtcaaaga 47052399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 213
Target Start/End: Original strand, 48108568 - 48108618
Alignment:
Q  163 gagatagccggattgtagcagatcgtgttcagtggttccaagcatgaagat 213  Q
    |||||| |||||||||||||||||||  ||| || ||||||||||||||||    
T  48108568 gagatacccggattgtagcagatcgtcctcattgcttccaagcatgaagat 48108618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University