View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0929_low_55 (Length: 214)

Name: NF0929_low_55
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0929_low_55
NF0929_low_55
[»] chr8 (1 HSPs)
chr8 (123-160)||(44680335-44680372)


Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 160
Target Start/End: Complemental strand, 44680372 - 44680335
Alignment:
Q  123 atgcttggaacatttctgctaaggtatctagagatgga 160  Q
    ||||||||||||||||||||||||||||||||||||||    
T  44680372 atgcttggaacatttctgctaaggtatctagagatgga 44680335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University