View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0929_high_16 (Length: 287)

Name: NF0929_high_16
Description: NF0929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0929_high_16
NF0929_high_16
[»] chr4 (2 HSPs)
chr4 (92-258)||(40820103-40820269)
chr4 (11-49)||(40820312-40820350)


Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 92 - 258
Target Start/End: Complemental strand, 40820269 - 40820103
Alignment:
Q  92 tatacagatagaaacttctattgctcgaatgaggcttgatcgttgccattacctccaaaaatcaaacatttttgttgccgtttactccagttttgccttc 191  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40820269 tatacagatagaaacttctgttgctcgaatgaggcttgatcgttgccattacctccaaaaatcaaacatttttgttgccgtttactccagttttgccttc 40820170  T
Q  192 ccaccagattcaacttccaccatggaggtgtccttttccaaatgacatgtgtgatgtgtgataatgc 258  Q
    |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  40820169 ccaccagattcaacctccaccatggaggtgttcttttccaaatgacatgtgtgatgtgtgataatgc 40820103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 49
Target Start/End: Complemental strand, 40820350 - 40820312
Alignment:
Q  11 cataggtcattaactcgtttctatatcttaggagttagg 49  Q
    |||||||||||||||||||||||| ||||||||||||||    
T  40820350 cataggtcattaactcgtttctatctcttaggagttagg 40820312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University