View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_289 (Length: 219)

Name: NF0928_low_289
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_289
NF0928_low_289
[»] chr5 (2 HSPs)
chr5 (124-202)||(43194323-43194401)
chr5 (124-196)||(43194495-43194567)


Alignment Details
Target: chr5 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 124 - 202
Target Start/End: Original strand, 43194323 - 43194401
Alignment:
Q  124 aagttaagattgaaccgttcaggtaacctaaccaaaacaaactaagttaagtcacctgaacgattcaatctcaaaatac 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43194323 aagttaagattgaaccgttcaggtaacctaaccaaaacaaactaagttaagtcacctgaacgattcaatctcaaaatac 43194401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 124 - 196
Target Start/End: Original strand, 43194495 - 43194567
Alignment:
Q  124 aagttaagattgaaccgttcaggtaacctaaccaaaacaaactaagttaagtcacctgaacgattcaatctca 196  Q
    |||| ||||||||| ||||||| ||||||||||||||||||||   ||| |||| | ||||||||||||||||    
T  43194495 aagtcaagattgaatcgttcagataacctaaccaaaacaaactcgattaggtcatcagaacgattcaatctca 43194567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University