View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0928_low_277 (Length: 232)

Name: NF0928_low_277
Description: NF0928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0928_low_277
NF0928_low_277
[»] chr4 (2 HSPs)
chr4 (46-232)||(51005576-51005771)
chr4 (1-52)||(51005805-51005856)
[»] chr7 (1 HSPs)
chr7 (1-33)||(38741827-38741859)


Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 46 - 232
Target Start/End: Complemental strand, 51005771 - 51005576
Alignment:
Q  46 cttttaggaatttatctcctatatt---gtatgttaaaatttggattgatttatcgcttatggatattctttgcttcaaattgtatataggaagaaaata 142  Q
    |||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51005771 cttttaggaatttatctcctatattattgtatgttaaaatttggattgatttatcgcttatggatattctttgcttcaaattgtatataggaagaaaata 51005672  T
Q  143 a----ataagtactatcttgtaaaactaggacatgggacatggcttctttaccaacaat--nnnnnnntagcacgacttttattttgatgggatat 232  Q
    |    |||||||||||||||||||||||||||| |||||||||||||||||||||||||          |||||||||||||||||||||||||||    
T  51005671 aataaataagtactatcttgtaaaactaggacacgggacatggcttctttaccaacaataaaaaaaataagcacgacttttattttgatgggatat 51005576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 51005856 - 51005805
Alignment:
Q  1 agaaatttgtaattcattcaaggaagtataggcatatattctctgcttttag 52  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51005856 agaaatttgtaattcattcaaggaagtataggcatatattctctgcttttag 51005805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 38741827 - 38741859
Alignment:
Q  1 agaaatttgtaattcattcaaggaagtataggc 33  Q
    ||||||||||| |||||||||||||||||||||    
T  38741827 agaaatttgtagttcattcaaggaagtataggc 38741859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University