View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0927_low_20 (Length: 324)

Name: NF0927_low_20
Description: NF0927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0927_low_20
NF0927_low_20
[»] chr4 (1 HSPs)
chr4 (85-233)||(27693472-27693622)


Alignment Details
Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 85 - 233
Target Start/End: Original strand, 27693472 - 27693622
Alignment:
Q  85 gtgtcttttaactaaatgtgtatctagtgcgnnnnnnnnn--acttacgcaagagaatgaagagaaatagagcgcgcactgctgtatcgtatatcatgct 182  Q
    |||||||||||||||||||||||||||||||           ||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||    
T  27693472 gtgtcttttaactaaatgtgtatctagtgcgtttttttttttacttacgcaagagaatgaagaaaaatagagcgcccattgctgtatcgtatatcatgct 27693571  T
Q  183 gcggtatgacaattgttcctcttcccggtcacggtctctgtcttgctgatg 233  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||    
T  27693572 ggggtatgacaattgttcctcttcccggtcacggtctctgtcttgctgatg 27693622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University