View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0922_low_48 (Length: 291)

Name: NF0922_low_48
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0922_low_48
NF0922_low_48
[»] chr7 (1 HSPs)
chr7 (222-278)||(1701952-1702008)


Alignment Details
Target: chr7 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 222 - 278
Target Start/End: Complemental strand, 1702008 - 1701952
Alignment:
Q  222 gtttcttgaccaacaagaaaccgattttttctcaatgctgcaactcaacagcacttc 278  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1702008 gtttcttgaccaacaagaaaccgattttttctcaatgctgcaactcaacagcacttc 1701952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University