View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0919_low_43 (Length: 241)

Name: NF0919_low_43
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0919_low_43
NF0919_low_43
[»] chr8 (1 HSPs)
chr8 (14-97)||(43083354-43083437)


Alignment Details
Target: chr8 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 14 - 97
Target Start/End: Complemental strand, 43083437 - 43083354
Alignment:
Q  14 tatatagtatatatactaagttttattatcaattaacgtgactaatctctatnnnnnnnnccgttacacacaagatgagttttt 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||        | ||||||||||||||||||||||    
T  43083437 tatatagtatatatactaagttttattatcaattaacgtgactaatctctataaaaaaacctgttacacacaagatgagttttt 43083354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University