View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0919_low_41 (Length: 249)

Name: NF0919_low_41
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0919_low_41
NF0919_low_41
[»] chr1 (1 HSPs)
chr1 (25-185)||(47067460-47067620)


Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 25 - 185
Target Start/End: Complemental strand, 47067620 - 47067460
Alignment:
Q  25 aaatgtcacaaaatatgaattgacatttgcaaaatcttcacccttgtctaagcaatgtctcttctttatctctcttacccttcttcttgttatttacctt 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47067620 aaatgtcacaaaatatgaattgacatttgcaaaatcttcacccttgtctaagcaatgtctcttctttatctctcttacccttcttcttgttatttacctt 47067521  T
Q  125 cacattacttcatgtgcatgagccacaccacttcaccaaatggggtggctgcaatcccttt 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47067520 cacattacttcatgtgcatgagccacaccacttcaccaaatggggtggctgcaatcccttt 47067460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University