View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0919_low_25 (Length: 321)

Name: NF0919_low_25
Description: NF0919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0919_low_25
NF0919_low_25
[»] chr6 (1 HSPs)
chr6 (89-203)||(5257829-5257943)


Alignment Details
Target: chr6 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 89 - 203
Target Start/End: Complemental strand, 5257943 - 5257829
Alignment:
Q  89 tatagtgcaaaaaggggggtgtgaatggttgattaaagatgctttagatttgtatttcaaatttatgatctccgagtagagatctcagacacgacacctt 188  Q
    ||||||||||||||||||||||||||||||||||||| |  |||||||||||||||||||||| ||||||||||||||||  ||||||||||| ||||||    
T  5257943 tatagtgcaaaaaggggggtgtgaatggttgattaaaaaatctttagatttgtatttcaaattaatgatctccgagtagaattctcagacacgtcacctt 5257844  T
Q  189 gtttcatagatttta 203  Q
    |||||||||||||||    
T  5257843 gtttcatagatttta 5257829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University