View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0917_low_83 (Length: 202)

Name: NF0917_low_83
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0917_low_83
NF0917_low_83
[»] chr1 (1 HSPs)
chr1 (1-116)||(42289196-42289311)


Alignment Details
Target: chr1 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 42289311 - 42289196
Alignment:
Q  1 tgcagtggcagacatgtgaggactagacatgttttgaccatgttgcattgaattgacaaaaccaacttgatgatcacttaaagagctattgttgttaatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42289311 tgcagtggcagacatgtgaggactagacatgttttgaccatgttgcattgaattgacaaaaccaacttgatgatcacttaaagagctattgttgttaatg 42289212  T
Q  101 taaagtgttgttcctt 116  Q
    ||||||||||||||||    
T  42289211 taaagtgttgttcctt 42289196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University