View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0912_low_50 (Length: 254)

Name: NF0912_low_50
Description: NF0912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0912_low_50
NF0912_low_50
[»] chr8 (2 HSPs)
chr8 (51-105)||(4580272-4580326)
chr8 (128-174)||(4580345-4580391)


Alignment Details
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 4580272 - 4580326
Alignment:
Q  51 aattccatcttgatgtttgatcattttcaggtttaggggatgtgttatattgaag 105  Q
    ||||||||||||||||||||||||| | |||||||||||||||||||||||||||    
T  4580272 aattccatcttgatgtttgatcattataaggtttaggggatgtgttatattgaag 4580326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 174
Target Start/End: Original strand, 4580345 - 4580391
Alignment:
Q  128 aaggaatgttatattgaagtttttgatactgtatttgatatttttgg 174  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  4580345 aaggaatgttatattgaagtttttgatactgtatttgatatttttgg 4580391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University