View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0911_high_5 (Length: 261)

Name: NF0911_high_5
Description: NF0911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0911_high_5
NF0911_high_5
[»] chr3 (1 HSPs)
chr3 (29-261)||(51668431-51668663)


Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 29 - 261
Target Start/End: Original strand, 51668431 - 51668663
Alignment:
Q  29 atgaaaaacctcctcttcttctccagatggttcgtgactccgaagatattaaattcatgtaaggtttattgttcggctggtttgattttcgcaacttgct 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51668431 atgaaaaacctcctcttcttctccagatggttcgtgactccgaagatattaaattcatgtaaggtttattgttcggctggtttgattttcgcaacttgct 51668530  T
Q  129 tatggtttagaaactgaatcatgaacaaacaacatattaaatctctttctctacaggtctgctttacggtccttcaaacgccgcgttgcctatgcaaata 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  51668531 tatggtttagaaactgaatcatgaacaaacaacatattaaatctctttctctacaggtctgctttacggtccttcaaacgccgcgttgcttatgcaaata 51668630  T
Q  229 ttcgttatgaccgtatccttttgttttagttca 261  Q
    |||||||||||||||||||||||||||||||||    
T  51668631 ttcgttatgaccgtatccttttgttttagttca 51668663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University